yxeO [2019-09-02 12:54:41]

putative S-(2-succino)cysteine ABC transporter (ATP-binding protein)

Locus: BSU_39480

Isoelectric point: 7.37

Molecular weight: 27.59 kDa

Protein length: 249 aa

Gene length: 750 bp

Function: uptake and utilization of S-(2-succino)cysteine

Product: putative S-(2-succino)cysteine ABC transporter (ATP-binding protein)

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → ABC transporters → Importers → Uptake of amino acids
• Metabolism → Amino acid/ nitrogen metabolism → Biosynthesis/ acquisition of amino acids → Biosynthesis/ acquisition of cysteine
• Metabolism → Additional metabolic pathways → Sulfur metabolism → Conversion of S-(2-succino)cysteine to cysteine
• Groups of genes → Membrane proteins

Gene

Coordinates: 4,058,029 → 4,058,778

Phenotypes of a mutant

• defective in the the ability to support the growth of Synechococcus leopoliensis CCAP1405/1 on agar media PubMed

The protein

Protein family

• ABC transporter superfamily (according to UniProt)

Paralogous protein(s)

• PstBB, YvrO, GlnQ, ArtR, TcyN, TcyC, PstBA

Structure

• 4YMS (from Caldanaerobacter subterraneus, 53% identity) PubMed

Localization

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• Genes: yxeK-snaB-yxeM-yxeN-yxeO-sndB-yxeQ
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CymR: repression, PubMed, in CymR regulon

  Regulation

  • repressed in the presence of cysteine (CymR) PubMed

  Additional information

  • the amount of the mRNA is substantially decreased upon depletion of RNase Y PubMed

Biological materials

Mutant

• MGNA-B711 (yxeO::erm), available at the NBRP B. subtilis, Japan
• 1A950 ( yxeO::cat), PubMed, available at BGSC
• BKE39480 (ΔyxeO::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TACTGTTATCAACTGATTTC, downstream forward: _UP4_CTTATATAAGAAGGGGAGAA
• BKK39480 (ΔyxeO::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TACTGTTATCAACTGATTTC, downstream forward: _UP4_CTTATATAAGAAGGGGAGAA

References

Loading